Information for NFAT(RHD)/Jurkat-NFATC1-ChIP-Seq(Jolma et al.)/Homer (Motif 142)


Reverse Opposite:

p-value:0.000e+00
log p-value:-2.986e+03
Information Content per bp:1.762
Total Number of Sequences:50000.6
Total Number of Target Sequences:4315.0
Total Instances of Motif:2875.8
Total Instances of Motif in Targets:1844.0
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

NFAT(RHD)/Jurkat-NFATC1-ChIP-Seq(Jolma et al.)/Homer

Match Rank:1
Score:1.00
Offset:0
Orientation:forward strand
Alignment:ATTTTCCATT
ATTTTCCATT

MA0152.1_NFATC2/Jaspar

Match Rank:2
Score:0.92
Offset:1
Orientation:forward strand
Alignment:ATTTTCCATT
-TTTTCCA--

MA0319.1_HSF1/Jaspar

Match Rank:3
Score:0.82
Offset:1
Orientation:reverse strand
Alignment:ATTTTCCATT
-TGTTCCAT-

dl/dmmpmm(SeSiMCMC)/fly

Match Rank:4
Score:0.78
Offset:-2
Orientation:forward strand
Alignment:--ATTTTCCATT
GGATTTTCC---

NFAT:AP1/Jurkat-NFATC1-ChIP-Seq(Jolma et al.)/Homer

Match Rank:5
Score:0.76
Offset:-9
Orientation:reverse strand
Alignment:---------ATTTTCCATT-
NTGACTCANTTTTTCCANTN

dl/dmmpmm(Pollard)/fly

Match Rank:6
Score:0.76
Offset:-2
Orientation:forward strand
Alignment:--ATTTTCCATT
GGATTTTCCC--

MA0294.1_EDS1/Jaspar

Match Rank:7
Score:0.75
Offset:-1
Orientation:reverse strand
Alignment:-ATTTTCCATT
ATTTTTCCG--

dl/dmmpmm(Down)/fly

Match Rank:8
Score:0.73
Offset:-3
Orientation:forward strand
Alignment:---ATTTTCCATT
TGGATTTTCC---

MA0390.1_STB3/Jaspar

Match Rank:9
Score:0.72
Offset:-7
Orientation:forward strand
Alignment:-------ATTTTCCATT----
GTCCAAAATTTTTCACTCTGG

dl-A/dmmpmm(Bergman)/fly

Match Rank:10
Score:0.70
Offset:-3
Orientation:forward strand
Alignment:---ATTTTCCATT
GGGTTTTTCCN--